Students of class 12 Biology should refer to MCQ Questions Class 12 Biology Molecular Basis of Inheritance with answers provided here which is an important chapter in Class 12 Biology NCERT textbook. These MCQ for Class 12 Biology with Answers have been prepared based on the latest CBSE and NCERT syllabus and examination guidelines for Class 12 Biology. The following MCQs can help you to practice and get better marks in the upcoming class 12 Biology examination

Chapter 6 Molecular Basis of Inheritance MCQ with Answers Class 12 Biology

MCQ Questions Class 12 Biology Molecular Basis of Inheritance provided below have been prepared by expert teachers of grade 12. These objective questions with solutions are expected to come in the upcoming Standard 12 examinations. Learn the below provided MCQ questions to get better marks in examinations.

Question. Which of the following are the functions of RNA?
(a) It is a carrier of genetic information from DNA to ribosomes synthesising polypeptides.
(b) It carries amino acids to ribosomes.
(c) It is a constituent component of ribosomes.
(d) All of the above.

Question. Antiparallel strands of a DNA molecule means that
(a) one strand turns clockwise
(b) one strand turns anti-clockwise
(c) the phosphate groups of two DNA strands, at their ends, share the same position
(d) the phosphate groups at the start of two DNA strands are in opposite position (pole).

Question. In addition to the human genome sequence, draft or finished genome sequences existed for eight model organisms by 2002. Which of the following organisms are not the part of that group of eight model organisms ?
(a) Saccharomyces cerevisiae
(b) Drosophila melanogaster
(c) Oryza sativa
(d) Quercus rubra

Question. With regard to mature mRNA in eukaryotes
(a) exons and introns do not appear in the mature RNA
(b) exons appear but introns do not appear in the mature RNA
(c) introns appear but exons do not appear in the mature RNA
(d) both exons and introns appear in the mature RNA

Question. Polysome is formed by
(a) a ribosome with several subunits
(b) ribosomes attached to each other in a linear arrangement
(c) several ribosomes attached to a single mRNA
(d) many ribosomes attached to a strand of endoplasmic reticulum.

Question. In E.coli, the lac operon gets switched on when
(a) lactose is present and it binds to the repressor
(b) repressor binds to operator
(c) RNA polymerase binds to the operator
(d) lactose is present and it binds to RNA polymerase

Question. In the DNA molecule
(a) the proportion of adenine in relation to thymine varies with the organism
(b) there are two strands which run antiparallel—one in 5l ” 3l direction and other in 3l ” 5l
(c) the total amount of purine nucleotides and pyrimidine nucleotides is not always equal
(d) there are two strands which run parallel in the 5l ” 3l direction.

Question. Nucleotides are linked by
(a) hydrogen bonds.
(b) phosphodiester bonds.
(c) peptic bonds.
(d) ionic bonds

Question. What is not true for genetic code?
(a) It is nearly universal.
(b) It is degenerate.
(c) It is unambiguous
(d) A codon in mRNAt is read in a non-contiguous fashion.

Question. While analysing the DNA of an organism a total number of 5386 nucleotides were found, out of which the proportion of different bases were: Adenine = 29%, Guanine = 17%, Cytosine = 32%, Thymine = 17%.
Considering the Chargaff’s rule it can be concluded that
(a) it is a double stranded circular DNA
(b) it is single stranded DNA
(c) it is a double stranded linear DNA
(d) no conclusion can be drawn

Question. Which of the following steps in transcription is catalysed by RNA polymerase?
(a) Initiation
(b) Elongation
(c) Termination
(d) All of the above

Question. RNA polymerases used for the transcription of genes require a ______ template.
(a) rRNA “
(b) DNA
(c) RNA
(d) mRNA

Question. The net electric charge on DNA and histones is
(a) both positive
(b) both negative
(c) negative and positive, respectively
(d) zero

Question. In some viruses, DNA is synthesised by using RNA as template. Such a DNA is called
(a) A-DNA
(b) B-DNA
(c) cDNA
(d) rDNA

Question. Gene controls
(a) protein synthesis but not heredity
(b) protein synthesis and heredity
(c) heredity but not protein synthesis
(d) biochemical reaction of some enzymes

Question. Identify the incorrect statement.
(a) In prokaryotes, the structural gene is polycistronic.
(b) In eukaryotes, structural genes have interrupted coding sequences.
(c) Eukaryotes have split gene arrangement.
(d) Intervening sequences appear in mature RNA.

Question. The promoter site and the terminator site for transcription are located at
(a) 3′ (downstream) end and 5′ (upstream) end, respectively of the transcription unit
(b) 5′ (upstream) end and 3′ (downstream) end, respectively of the transcription unit
(c) the 5′ (upstream) end
(d) the 3′ (downstream) end

Question. The human chromosome with the highest and least number of genes in them are respectively
(a) Chromosome 21 and Y
(b) Chromosome 1 and X
(c) Chromosome 1 and Y
(d) Chromosome X and Y

Question. If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is: 5′ – A T G A A T G – 3′, the sequence of bases in its RNA transcript would be
(a) 5′ – A U G A A U G – 3′
(b) 5′ – U A C U U A C – 3′
(c) 5′ – C A U U C A U – 3′
(d) 5′ – G U A A G U A – 3′

Question. Who amongst the following scientists had no contribution in the development of the double helix model for the structure of DNA?
(a) Rosalind Franklin
(b) Maurice Wilkins
(c) Erwin Chargaff
(d) Meselson and Stahl

Question. Escherichia coli fully labelled with 15N is allowed to grow in 14N medium. The two strands of DNA molecule of the first generation bacteria have
(a) different density and do not resemble with their parent DNA.
(b) different density but resemble with their parent DNA.
(c) same density and resemble with their parent DNA.
(d) same density but do not resemble with their parent DNA.

Question. Discontinuous synthesis of DNA occurs in one strand, because
(a) DNA molecule being synthesised is very long
(b) DNA dependent DNA polymerase catalyses polymerisation only in one direction (5′ → 3′)
(c) it is a more efficient process
(d) DNA ligase joins the short stretches of DNA

Question. Amino acid sequence, in protein synthesis is decided by the sequence of  
(a) rRNA
(b) tRNA
(c) mRNA
(d) cDNA

Question. Control of gene expression in prokaryotes take place at the level of
(a) DNA-replication
(b) Transcription
(c) Translation
(d) None of the above

Question. Which of the following statements is the most appropriate for sickle cell anaemia?
(a) It cannot be treated with iron supplements
(b) It is a molecular disease
(c) It confers resistance to acquiring malaria
(d) All of the above

Question. How many of the given statements (i-iv) is/are correct?
(i) In transcription, adenosine pairs with uracil.
(ii) Regulation of lac operon by repressor is referred to as positive regulation.
(iii) The human genome has approximately 50,000 genes.
(iv) Haemophilia is a sex-linked recessive disease.
(a) Two
(b) Three
(c) Four
(d) One

Question. Which of the following statements is correct about the role of regulatory proteins in transcription in prokaryotes?
(a) They only increase expression
(b) They only decrease expression
(c) They interact with RNA polymerase but do not affect the expression
(d) They can act both as activators and as repressors

Question. The most abundant type of RNA in the cell is
(a) rRNA
(b) mRNA
(c) t RNA
(d) hn RNA

Question. Which was the last human chromosome to be completely sequenced?
(a) Chromosome 1
(b) Chromosome 11
(c) Chromosome 21
(d) Chromosome X

Question. If Meselson and Stahl’s experiment is continued for four generations in bacteria, the ratio of N15/N15: N15/N14: N14/N14 containing DNA in the fourth generation would be
(a) 1:1:0
(b) 1:4:0
(c) 0:1:3
(d) 0:1:7

Question. During translation, proteins are synthesized by
(a) ribosomes using the information on DNA.
(b) lysosome using the information on DNA.
(c) ribosome using the information on mRNA.
(d) lysosome using the information on mRNA.

Question. Clover leaf secondary structure of tRNA has a loop for
(a) three nucleotides of a codon.
(b) three nucleotides of an anticodon.
(c) no nucleotides.
(d) both (a) and (b)

Question. DNA is a polymer of nucleotides which are linked to each other by 3′→ 5′ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
(a) Replace purine with pyrimidines
(b) Remove/replace 3′ OH group in deoxyribose
(c) Remove/replace 2′ OH group with some other group in deoxyribose
(d) Both ‘b’ and ‘c’

Question. Removal of introns and joining the exons in a defined order in a transcription unit is called
(a) tailing
(b) transformation
(c) capping
(d) splicing

Question. Nucleotide arrangement in DNA can be seen by
(a) X-ray crystallography
(b) electron microscope
(c) ultracentrifuge
(d) light microscope

Question. Chargaff’s rules are applicable to
(a) single stranded RNA.
(b) single stranded DNA and RNA.
(c) single stranded DNA.
(d) double stranded DNA

Question. What sequence on the template strand of DNA corresponds to the first amino acid inserted into a protein ?
(a) TAC
(b) UAC
(c) UAG
(d) AUG

Question. Nucleosome is
(a) intron interrupted DNA.
(b) double helix DNA.
(c) negatively charged DNA wrapped around positively charged histone octomer.
(d) satellite DNA.

Question. If a double stranded DNA has 20% of cytosine, what will be the percentage of adenine in it?
(a) 20%
(b) 40%
(c) 30%
(d) 60%

Question. In some viruses, RNA is present instead of DNA indicating that 
(a) their nucleic acid must combine with host DNA before replication.
(b) they cannot replicate.
(c) there is no hereditary information.
(d) RNA can act to transfer heredity.

Question. Leading strand during DNA replication is formed
(a) continuously.
(b) in short segments.
(c) first.
(d) ahead of replication.

Question. DNA replication is
(a) conservative and discontinuous.
(b) semi-conservative and semi-discontinuous.
(c) semi-conservative and discontinuous.
(d) conservative.

Question. Initiation codon of protein synthesis (in eukaryotes) is
(a) GUA
(b) GCA
(c) CCA
(d) AUG

Question. In eukaryotes, mRNA is synthesized with the aid of
(a) RNA polymerase III.
(b) RNA polmerase II.
(c) RNA polymerase I.
(d) reverse transcriptase.

Question. Lactose operon produces enzymes
(a) b-galactosidase, permease and glycogen synthetase.
(b) b-galactosidase, permease and transacetylase.
(c) permease, glycogen synthetase and transacetylase.
(d) b-galactosidase, permease and phosphoglucose isomerase.

Question. Polymorphism in DNA sequence
(a) is the basis of genetic mapping of human genome.
(b) arises due to mutation.
(c) is the basis of DNA finger printing.
(d) All of the above

Question. VNTRs are
(a) Variable Number of Tandem Repeats.
(b) Very Narrow Tandem Repeats.
(c) Variable Non-cistronic Transposon Repeats.
(d) Valuable Non-cistronic Transposon Regions.

Question. Select the correct statement regarding protein synthesis.
(a) When the small subunit of the ribosome encounters an mRNA the process of translation begins.
(b) Peptidase catalyses the formation of peptide bond.
(c) UTRs are present between the start codon and stop codon.
(d) At the end of translation, the release factor binds to the initiation codon.

Question. Choose the incorrect statement regarding the observations drawn from the human genome project.
(a) Repetitive sequences are stretches of RNA.
(b) Less than 2 per cent of the genome codes for protein.
(c) SNPs help in tracing human history.
(d) Repetitive sequences make up a very large portion of the human genome

Question. Methyl guanosine triphosphate is added at 5′ end of hn-RNA in a process of
(a) tailing
(b) splicing
(c) capping
(d) None of these

Question. DNA replication is semi-conservative as
(a) only non-parent strand acts as template.
(b) both strands of new molecule are synthesized de novo.
(c) one of the strand in each new molecule is parental and the other is new.
(d) daughter strands are dispersive.

Question. The removal of which enzyme affects the synthesis of hnRNA in eukaryotes         
(a) RNA polymerase II
(b) RNA primase
(c) RNA polymerase III
(d) RNA polymerase I

Question. Sickle cell anemia is caused     
(a) When valine is replaced by glutamic acid in beta polypeptide chain
(b) When glutamic acid is replaced by valine in beta polypeptide chain
(c) When glutamic acid is replaced by valine in alpha polypeptide chain
(d) When valine is replaced by glutamic acid in alpha polypeptide chain

Question. Wobble position means         
(a) Base paring
(b) altered base on code
(b) third altered base on codon
(d) none of the above

Question. Cistron is         
(a) The coding sequence of DNA
(b) The functional unit of DNA molecule that codes for a particular gene product
(c) Intervening non coding sequence of DNA
(d) The sequences which are removed during RNA splicing.

Question. Peptidyl transferase       
(a) Is a 23s rRNA
(b) forms peptide bonds
(c) component of ribosome
(d) all the three

Question. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?     
(a) AUGUUAAUAGACGAGUAGCGACGAUGU
(b) AUGAGACGGACUGCAUUCCCAACCUGA
(c) AUGCCCAACCGUUAUUCAUGCUAG
(d) AUGUCGACAGUCUAAAACAGCGGG

Question. If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA         
(a) 30%
(b) 10%
(c) 90%
(d) 40%

Question. Arrange the following events in the order of synthesis of a protein       
i) A peptide bond forms
ii) A tRNA matches its anticodon to the codon in the A- site
iii) The movement of second tRNA complex from A-site to P-site
iv) The large subunit attaches to the small subunit and the initiator tRNA fits in the P-site
v) A small subunit binds to the mRNA
vi) The activated amino acid tRNA complex attaches the initiation codon on mRNA
(a) iv, v, iii, ii, i, vi
(b) iv, vi, v, ii, I, iii
(c) v, iv, iii, ii, vi, I
(d) v, vi, iv, ii, i, iii

Question. Select the incorrect statement out of the five given below about lac operon when Lactose is present in the medium.       
(a) Gene – A gets transcribed into mRNA which produces β-galactoside permease
(b) Inducer-Repressor complex is formed
(c) Lactose inactivates repressor protein
(d) RNA polymerase transcribe Z-gene, Y-gene and A-gene
(e) Allolactose is the inducer of lac operon

Question. Match the entries in column I with those of column II and choose the correct answer.           
     Column I                                   Column II
A) Alkali treatment        M) separation of DNA fragments on gel slab
B) Southern blotting      N) split DNA fragments into single strands
C) Electrophoresis         O) DNA transferred to nitrocellulose sheet
D) PCR                         P) X-ray photography
E) Autoradiography Q) produce fragments of different sizes
F) DNA treated with REN R) DNA amplification
(1) A – N, B- Q, C- P, D- R, E- M, F – O
(2) A – P, B – R, C – M, D -O, E – N, F – Q
(3) A – Q, B – O, C – M, D – R, E – P, F – N
(4) A – N, B – O, C – M, D – R, E – P, F – Q

Question. Match the names of scientists in column I with their achievements in column II and choose the correct answer given below           
      Column I                 Column II
A) Watson and Crick     P) DNA fingerprinting
B) R.W. Holley             Q) Decipher genetic code
C) Marshal Nirenberg   R) Double helix of DNA
D) Jacob and Monod    S) Clover model of tRNA
E) Alec Jeffrey             T) Lac operon concept
(A) (B) (C) (D) (E)
(a) R S P T Q
(b) R S Q T P
(c) R Q P T S
(d) R T S P Q

Question. Which of the statements give below is correct with respect to frameshift mutation         
(a) a single nucleotide base change, insertion, or deletion of the genetic material
(b) Glutamine is replaced by valine
(c) Sickle cell anemia is an example
(d) insertions or deletions of a number of nucleotides in a DNA sequence that is not divisible by three.

Question. The transcription initiation factor associated with the RNA polymerase holoenzyme in prokaryotes is         
(a) β
(b) ω
(c) σ
(d) αI

Question. What is not True for DNA in prokaryotes         
(a) present in the form of a compact structure called nucleoid
(b) the coils are maintained by non-histone basic proteins
(c) found in cytoplasm in a supercoiled condition
(d) packaged as nucleosomes along with histones

Question. The structural genes of lac operon transcribe mRNA which is       
(a) polycistronic
(b) replicative
(c) monokaryotic
(d) monocistronic

We hope the above multiple choice questions for Class 12 Biology for Chapter 6 Molecular Basis of Inheritance provided above with answers based on the latest syllabus and examination guidelines issued by CBSE, NCERT and KVS are really useful for you. Molecular Basis of Inheritance is an important chapter in Class 12 as it provides very strong understanding about this topic. Students should go through the answers provided for the MCQs after they have themselves solved the questions. All MCQs have been provided with four options for the students to solve. These questions are really useful for benefit of class 12 students. Please go through these and let us know if you have any feedback in the comments section.